Read order in supplementary reads diagram

[minw2828]

Hello,

Thank you for developing the Supplementary Reads Diagram feature. It is great! :)

Could you help me understand how the Read Order was determined in IGV (2.19.1), please?

Here is a read (approximately 12,870 nt in length) with a primary alignment and a supplementary alignment in the SAM file:

m84031_230819_191531_s3/188744736/ccs	2064	chr13	32216996	60	1005=1X411=1X264=1D414=1I394=10379S	...	...	SA:Z:chr13,32335803,-,6402S505=5I2610=1X1949=1X1397=,60,2;
m84031_230819_191531_s3/188744736/ccs	16	chr13	32335803	60	6402S505=5I2610=1X1949=1X1397=	...	...	SA:Z:chr13,32216996,-,1005=1X411=1X264=1D414=1I394=10379S,60,2;

The same read was shown in the Supplementary Reads Diagram` as below:

I can understand the alignment order, which corresponds to what is shown in the SAM file, but I don't understand why the two segments in the read order were flipped.

How should I interpret this read order? Does it imply that the individual who carries this sequence has flipped segments compared with the reference genome? If the answer to this question is yes, does it imply a new type of variation outside inversion and translocation?

If I just looked at the SAM outputs, I would incline to think this read carries a deletion, as the distance between breakpoints on the same strand (approx 116,317 nt) is much larger than the read length itself.

Many thanks,
Min

[jrobinso]

I can't help you with interpretation, but read order is just what the name implies. It is the order of the segments in the original (unaligned) read sequence. Of course there are an infinite variety of variations, not everything fits in a simple class.

[minw2828]

Hi Jim,

Thank you for your reply.

I am afraid the read order illustration in this case was incorrect.

I went back to check the original read sequence before alignment. Here is what I found:

For the first 10 characters of the aligned sequence:

m84031_230819_191531_s3/188744736/ccs	2064	chr13	32216996	60	1005=1X411=1X264=1D414=1I394=10379S	CAGTGCCCTA...	...	...	SA:Z:chr13,32335803,-,6402S505=5I2610=1X1949=1X1397=,60,2;

its reverse complementary sequence only matched with the last 10 characters of the original read sequence.

Whereas for the last 20 characters of the aligned sequence:

m84031_230819_191531_s3/188744736/ccs	16	chr13	32335803	60	6402S505=5I2610=1X1949=1X1397=	...TGGGCAACAGAGCGAGACT	...	...	SA:Z:chr13,32216996,-,1005=1X411=1X264=1D414=1I394=10379S,60,2;

its reverse complementary sequence only matched with the first 20 characters of the original read sequence.

The first and last segments of original read sequence were:

AGTCTCGCTCTGTT ... TGTCCCAGGTGTACAACCTTAGGGCACTG

This means that the original read sequence aligned linearly to the reverse strand of the reference genome, with a large deletion in between. Hence, the Alignment Order should be the same as the Read Order in the Supplementary Reads Diagram.

I love this Supplementary Reads Diagram feature. I think it is very useful. Thank you very much for creating it!

Many thanks,
Min