Skip to content

Latest commit

 

History

History
159 lines (137 loc) · 13.7 KB

MANUAL.md

File metadata and controls

159 lines (137 loc) · 13.7 KB

cld can be called either with “--version”, printing its version number and copyrights, “--help” printing a more elusive help documentation and with “--task”.

EXAMPLE to execute from the path containing all needed files:

cld -—task=end_to_end —-output-dir=. --parameter-file=./params.txt --gene-list=./gene_list.txt

cld can run 2 distinct tasks, database creation and library design.

Database creation is called using the “--task=make_database” command giving the organism name of interest, as it is denoted in ENSEMBLs ftp folder structure e.g. homo_sapiens, and the rsync url to the current ftp server of ENSEMBL, examples can be found when cld --help is called. After calling this function CLD will automatically download the latest toplevel FASTA, GFF and GTF files for the organism of interest and compile a database containing bowtie indexes, mygff files and reformatted sequence files. If not enough computing power is available to the user, these databases also might be downloaded from http://www.dkfz.de/signaling/crispr-downloads/.

Library design can either be done in two steps: “cld --task=target_ident” and then “cld --task=library_assembly” if the user wants to separate the two steps for example in order to only identify target sites without compiling a clonable library. Else “cld --task=end_to_end” which automatically will perform the steps mentioned before and present the end-result in a user defined output folder. For reasons of manageability for high throughput design, output files are kept as simple and standardised as possible. However a genome wide library targeting the human genome quickly spans several GB depending on how strict the parameters are chosen. Since the end_to_end task takes most time we benchmarked its time consumption to be approximately 1 h wall-time for an 8-core cpu node.

For running cld from the command line the following syntax must be used.

Usage: cld --task=end_to_end [options=value] ... Options: --task= make_database to provide an cld ready data base. --organism= Specify an organism to build the database for. it must be one of the organisms available in ENSEMBLs ftp repository. And in the same format as its ENSEMBL ftp directoy name. E.g.: drosophila_melanogaster or homo_sapiens

	    --rsync-link=<rsync://path/to/dir>	         Specify an ftp repository to build the database from.
							    it must be one of the organisms available in ENSEMBLs ftp repository.
							    And in the same format as its ENSEMBL rsync directoy path.
							    E.g.: 
							    rsync://ftp.ensembl.org/ensembl/pub/release-81/
							    
							    rsync://ftp.ensemblgenomes.org/all/pub/protists/current/

								rsync://ftp.ensemblgenomes.org/all/pub/plants/current/

								rsync://ftp.ensemblgenomes.org/all/pub/fungi/current/
								
								rsync://ftp.ensemblgenomes.org/all/pub/metazoa/current/

	 target_ident 					to identify target sequences.
	    --output-dir=<path/to/dir>			- a working directory as unix path to directory.
	    --parameter-file=<path/to/dir>		- a parameter file in cld format as path to file.
	    --gene-list=<path/to/dir>			- a gene list file with ENSEMBL IDs new-line seprated as path to file.
		--scoring-module=<path/to/dir>		- the path and filename of a file defining a perl scoring function

	 library_assembly 				to format a library from an identification folder.
	    --output-dir=<path/to/dir>			- a working directory as unix path to directory.
	    --parameter-file=<path/to/dir>		- a parameter file in cld format as path to file.
	    --gene-list=<path/to/dir>			- a gene list file with ENSEMBL IDs new-line seprated as path to file. 
	    --cov=<int>						- Specify the minimum gene coverage as <int> default(15)
	    --lib-size=<int>				- Specify the maximum library size as <int> default(2000)
	    --lib-name=<string>				- Prefix for the final library as <string> default(test_lib).
	    --5-prime=<string>				- Define the adapter to be put in 5' before the target site.
											default(CTGAGCTCATAGAAGACCTCACC)
	    --3-prime=<string>				- Define the adapter to be put in 3' behind the target site.
							   				default(GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTGGGTCTTCGTTCG)
	    --cor-5-prime=<string>			- Specify if the first 5' baspair should be corrected to a G
							   				 may be "true" or "false" default :true.	    
	    --input-folder=<path/to/dir>		- Specify the input folder for library assembly.
							    			this folder must be prepared by --task= target_ident
		--spread-over-transcripts=<string>	- should the designs be equally spread oer the different transcripts of the gene
												-an be : true or false (default:true)

	 end_to_end 							to perform and end-to-end analysis from target identification to library formatting
	    --output-dir=<path/to/dir>			- a working directory as unix path to directory.
	    --parameter-file=<path/to/dir>		- a parameter file in cld format as path to file.
	    --gene-list=<path/to/dir>			- a gene list file with ENSEMBL IDs new-line seprated as path to file. 
	    --cov=<int>						- Specify the minimum gene coverage as <int> default(15)
	    --lib-size=<int>				- Specify the maximum library size as <int> default(2000)
	    --lib-name=<string>				- Prefix for the final library as <string> default(test_lib).
	    --5-prime=<string>				- Define the adapter to be put in 5' before the target site.
							    			default(CTGAGCTCATAGAAGACCTCACC)
	    --3-prime=<string>				- Define the adapter to be put in 3' behind the target site.
							    			default(GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTGGGTCTTCGTTCG)
	    --cor-5-prime=<string>			- Specify if the first 5' baspair should be corrected to a G.
		--spread-over-transcripts=<string>	- should the designs be equally spread oer the different transcripts of the gene
												-can be : true or false (default:true)
		--scoring-module=<path/to/dir>		- the path and filename of a file defining a perl scoring function

    --version							- Show version.
    --help								- Show this message.

In the following table every parameters as can be defined in the parameter-file is explained in more detail.

parameter explanations type/value
purpose_exclusive defines if the pupose exclusive choice should affect the design filtering criteria boolean (1 or 0)
min_length defines the minimum length of the protospacer (5' sequence before the PAM) numeric
max_length defines the maximum length of the protospacer (5' sequence before the PAM) numeric
min_G defines minimum total G content numeric
max_G defines maximum total G content numeric
min_A defines minimum total A content numeric
max_A defines maximum total A content numeric
min_C defines minimum total C content numeric
max_C defines maximum total C content numeric
min_T defines minimum total T content numeric
max_T defines maximum total T content numeric
right_homology if homology arms are chosen, this number defines the length of the arm 5' of the target site numeric
left_homology if homology arms are chosen, this number defines the length of the arm 3' of the target site numeric
downstream_window defines the 5' nucleotide distance window of a design to the start or stop codon for tagging analysis numeric
upstream_window defines the 3' nucleotide distance window of a design to the start or stop codon for tagging analysis numeric
number_of_CDS defines the allowed nucleotid number within CDS downstream of the start codon, if knockout is chosen as the purpose criterium numeric
minspacerlength defines the minimum spacer length, if paired design is chosen as the purpose criterium (as for the double nickase or FokI Cas9 approach) numeric
maxspacerlength defines the maximum spacer length, if paired design is chosen as the purpose criterium (as for the double nickase or FokI Cas9 approach) numeric
preceding defines if the protospacer should begin with a specific base (example: U6 promotor would favour G at this position) IUPAC coded Nucleotide
PAM_location defines if the PAM motif is 3' or 5' located with respect to the protospacer 3_prime or 5_prime
PAM defines the PAM sequence, which can be NAG, NGG or any (allowing both) IUPAC coded Nucleotides
ignore_intergenic defines if off-targets which are not in any gene should be ignored boolean (1 or 0)
purpose defines following purposes: knockdown/-out as pupose requires designs to hit in coding sequences near the start codon of a gene, N-terminal tagging requires the start codon to be targeted and C-terminal tagging requires the stop codon to be targeted by sgRNAs knockout, n-tagging, c-tagging, non-coding, CRISPRa or CRISPRi
gene_exclusive defines if the sgRNA needs to target a region within the targeted gene (for CRISPRa/i 500 before and after the gene are parsed too) boolean (1 or 0)
exon_exclusive defines if the sgRNA needs to target a region within an exon boolean (1 or 0)
CDS_only defines if the sgRNA needs to target a region within a coding region boolean (1 or 0)
CpG_exclusive defines if the sgRNA is allowed to target a region within a CpG island boolean (1 or 0)
specific_exon defines if a specific exon number is to be targeted numeric
retrieve_recomb_matrix defines if the sequences for homology arms should be computed and reported boolean (1 or 0)
bowtie_version defines which version of bowtie or blast should be used for off-target analysis. Bowtie is more sensitive to mismatches of single designs, and bowtie2 is optimized for paired alignments of sequences. Here Blast tends to be the most sensitive towards less homologous sequences. For all mapping algorithms only full-length alignments are counted. bowtie, bowtie2 or blast
offtargetdb defines if off-targets should be searched in genomic sequences, sequences of annotated genes or exons of protein coding sequences genomeDNA, gDNA or cDNA
off-targets-allowed defines how many off-targets per design are tolerated before it is excluded from the report numeric
unspecific_leading_bases defines the number of 5' base pairs of the target site to be ignored for the off-target mapping numeric
edit_distance_allowed defines the edit distance (sum of all mismatch or INDEL positions) allowed during alignment to be still counted as off-target numeric
bowtie_mode define the bowtie mode as referenced in the bowtie2 manual sensitive, very sensitive, fast, very-fast
sec_off_target defines if sgRNA targets sites that are not in the genome of interest (for example: GFP etc.). Those sequences need to be provided in an extra fasta formatted file in the database path and named 'secondary_off_targets.fasta' boolean (1 or 0)
max_per_exon defines the maximum number of sgRNA allowed to be reported per exon numeric
out_gff defines if a gff should be generated boolean (1 or 0)
specific_transcript defines if only a specific transcript (provided as an ENSEMBL TR ID) should be targeted. This is not applicable if more than one gene is searched. ENSEMBL transcript ID or any
match_info defines if a detailed alignment information should be printed on any sgRNA mapping boolean (1 or 0)
draw_html_report defines if an html report should be created boolean (1 or 0)
working_path defines if an unix path to the results should be used, else results are created in the current working directory (.) e.g. /data/workdir/
databasepath defines if an unix path to the folder containing CLD formatted databases should be generated e.g. /data/databases/
ref_organism defines the reference organism as given in the name of the database and the sub-directories e.g. if the organisms is homo_sapiens, the database needs to have the prefix homo_sapiens e.g. homo_sapiens , drosophila_melanogaster
data_type defines if the input file contains official gene symbols, ENSEMBL IDs or genomic coordinates. Coordinates need to be given as ID, chromosome (Ensembl_type), start, end. Coordinate data need to be tab separated and different entries need to be newline separated should be either ensemble_acc, gene_symbol or coordinates
ignore_missing_id defines if the program should die if IDs are faced, that can not be found in the currently used database boolean (1 or 0)
kind defines if sgRNA target sites should be found in a single or paired mode (suitable for the paired nickase or FokI paired nuclease approach) single or double
exclude_overlapping_genes defines if sgRNA designs targeting multiple overlapping genes/ antisense transcripts should be excluded boolean (1 or 0)
sort_by_rank defines if sgRNAs should be ranked additionallly by an on-target score boolean (1 or 0)
scores defines the on-target score to be used. The preset scores are derived from the algorithms proposed by Xu et al. 2015 and Doench et al. 2014. However they are only defined for a 20 nt protospacer adjacent to a NGG PAM. xu_score, doench_old or custom
custom_score defines a custom scoring function in perl code. the function needs to be unnamed and dependent on sequence information of the 30mer described in Doench et al.. Results of the function need to be numeric. string in perl language defining a anonymous funtion, which acts on the Doench 30mer
cover_many_transcripts defines if priority in sgRNA choice for the final library should be given on maximum coverage of all transcripts of a gene. All other scores will be ignored but shown in the resulting tables. boolean (1 or 0)