Unable to retrieve specific exons

[gouinK]

What happened?

When attempting to retrieve the nucleotide sequence of specific exon IDs, I get an error that the ID was not found, even though other exon IDs belonging to the same transcript isoform are able to be found. I have tried this at different times on different days in case it was an issue with the Ensembl server, but I get the same error for the same IDs each time. Maybe this is caused by a different Ensembl release version? Is the version specifiable with gget.seq ?

Thank you!

gget version

0.27.9

Operating System (OS)

Linux

User interface

Python

Are you using a computer with an Apple M1 chip?

Not applicable

What is the exact command that was run?

gget.seq('ENSE00001967169')
gget.seq('ENSE00001988220')
gget.seq('ENSE00001963723')
gget.seq('ENSE00002551899')
gget.seq('ENSE00003725582')
gget.seq('ENSE00004080633')
gget.seq('ENSE00004080649')
gget.seq('ENSE00004081368')
gget.seq('ENSE00004080632')

Which output/error did you get?

Fri Mar 21 14:15:02 2025 INFO Requesting nucleotide sequence of ENSE00001967169 from Ensembl.
['>ENSE00001967169 chromosome:GRCh38:15:96327199:96327348:-1',
 'GACTTTGGACTCACGTAGGCATAGGAGAACGAAACTTCTGTACATTTTAATCTGAATAATTCTTCAGGATTTAAAATTAATTGGCTCTGGCTTGGTTGGACCGTACTCGGATCTCGCCACCTCTGCGTTTCCCGAGTCACTGGCGAAGAG']
Fri Mar 21 14:15:02 2025 INFO Requesting nucleotide sequence of ENSE00001988220 from Ensembl.
['>ENSE00001988220 chromosome:GRCh38:15:96290630:96290783:-1',
 'GTCCCAGTTCCTCTGGGAATCGTCCTGTATGCAACATCTTCACAAGAGTGGCAGGCAGTTGAATCTCTGGCCTTCGTGGGACCACTGGACATCTGGCAGAGAACCAGGAAACCACGGTTCCCTTCTGTGAGTCCCTCAGCCGGAAAACTACAAG']
Fri Mar 21 14:15:02 2025 INFO Requesting nucleotide sequence of ENSE00001963723 from Ensembl.
['>ENSE00001963723 chromosome:GRCh38:15:96271703:96271798:-1',
 'ATCCAAATCCTGTCTTCACTGGCTTCAAGAATCCTGTCTTCACTGGCTTCAAAACTGGGATGAAGGAGGCTCCTTAGTGGAGAGCAAAGCAAAGAG']
Fri Mar 21 14:15:02 2025 INFO Requesting nucleotide sequence of ENSE00002551899 from Ensembl.
['>ENSE00002551899 chromosome:GRCh38:15:96191352:96191394:-1',
 'ATGAGTGTAAGGCCATTATCATGGACTTTTTCCCCAGCTGCAG']
Fri Mar 21 14:15:02 2025 INFO Requesting nucleotide sequence of ENSE00003725582 from Ensembl.
['>ENSE00003725582 chromosome:GRCh38:15:96125985:96126115:-1',
 'GTGCATGATTTCCCACTTACCTCCCGCAACCACTACCACCCACGTTGTCCACAGTATTCAGCTGTCTCAGGGAGGATCACAATTATTCTAATGGGACTGCAAAGAGTGAAGGACACAGCTTTTAACATCAG']
Fri Mar 21 14:15:02 2025 ERROR ID ENSE00004080633 not found. Please double-check spelling/arguments and try again.
[]
Fri Mar 21 14:15:03 2025 ERROR ID ENSE00004080649 not found. Please double-check spelling/arguments and try again.
[]
Fri Mar 21 14:15:03 2025 INFO Requesting nucleotide sequence of ENSE00004081368 from Ensembl.
['>ENSE00004081368 chromosome:GRCh38:15:96084528:96084647:-1',
 'AGGAAAAAAAAAACAGATTTCAAATGTGCCCGTGGACTTCGAGCTGGTGCGTTCAGTGGCAAAGCTGGAATTCAAATCTCAGGGCTCCTGCTCTGGGCTTCTTCTCCATGAAACTTGGAG']
Fri Mar 21 14:15:03 2025 ERROR ID ENSE00004080632 not found. Please double-check spelling/arguments and try again.
[]

[lauraluebbert]

Hi Kenny, thank you for reaching out! I was able to reproduce your error, and I reached out to Ensembl so we can figure out whether this is a gget or an Ensembl API issue. I'll post an update here as soon as I hear back from them. Have a great weekend!