This is an early version of PORPIDpipeline written for use with samples containing two UMIs (dUMI). It was originally created by Alec Pankow and then adapted by Dylan Westfall to provide matched sUMI and dUMI datasets for the analysis in the manuscript "Optimized SMRT-UMI protocol produces highly accurate sequence datasets from diverse populations – application to HIV-1 quasispecies" Westfall et al. It uses the sample ID and UMI of the sUMI primer for initial demultiplexing, QC and template identification. The "likely-real" families from UMI1 are then passed on for UMI2 identification and grouping using the dUMI primer sequence. The pipeline provides information on UMI combinations and frequency in the tagged directory as well as consensus sequences derived from all reads in a UMI1 collection (sUMI) or only the most prevalent UMI1-UMI2 combination (dUMI).

PORPIDpipeline https://github.com/MurrellGroup/PORPIDpipeline.git

Quick start

Dependencies (on an ubuntu machine)

• first update all apps
  • apt update
  • apt upgrade
• Snakemake
  • apt-get install -y snakemake
• mafft
  • apt-get install -y mafft
• fasttree
  • apt-get install -y fasttree
• python3 packages
  • apt-get install python3-pandas
  • apt-get install python3-seaborn

Julia version 1.7

Download and unpack the latest Julia (we recommend version 1.7.1) from:

https://julialang.org/downloads/

Make sure you can enter the julia REPL from the command line, on an ubuntu machine you would do:

# move the julia system to a lib directory
mv julia-1.7.1 /usr/lib/julia-1.7.1
# make julia v1.7.1 executable from the command line
ln -s /usr/lib/julia-1.7.1/bin/julia /usr/local/bin/julia
# check that you can enter the julia REPL
julia --version

cloning the PorpidPostproc repository

Now that the dependencies are setup we clone the PorpidPostproc repository

cd ~
git clone -b https://github.com/MullinsLab/sUMI_dUMI_comparison.git

setting up the Julia package environment

then navigate to the sUMI_dUMI_comparison project folder and start the Julia REPL. Enter the package manager using ] and then enter

activate .
instantiate
precompile

This will activate, install, and precompile the julia environment specified by the Project.toml and Manifest.toml files. The precompile command above is not strictly needed but is useful if there are issues with installing the julia packages listed in Project.toml

Next, add the following text to your Julia startup file (typically at ~/.julia/config/startup.jl; you may need to create the directory if not present, mkdir -p ~/.julia/config).

using Pkg
if isfile("Project.toml") && isfile("Manifest.toml")
    Pkg.activate(".")
end

This will activate the local environment at Julia startup.

Configuration

For this project, libraries are expected to contain a forward (sUMI) and reverse (dUMI) UMI primer. The config file is expected to follow this formatting scheme (see example_config.yaml):

dataset001:
  template001:
    Forward_Primer_2ndRd_Sequence: GATCTACACTCTTTCCCTACACGAC
    Reverse_Primer_2ndRd_Sequence: AGATGTGTATAAGAGACAGCCGCTCCGTCCGACGACTCACTATA
    sUMI_Primer_Sequence: actataNNNNNNNNTTAGAGACATCCCCAGAGCTGTTAG
    dUMI_Primer_Sequence: NNNNNNNNATAGCTGTCTTTTATC

The PCR and UMI primer sequences provided will be used for demultiplexing and will be trimmed from the final sequences. Forward_Primer_2ndRd_Sequence and Reverse_Primer_2ndRd_Sequence are the 2nd rd PCR primers.

CCS .fastq files should be placed in the fastq/ subdirectory and named according to the the dataset name used in the example_config.yaml file, ie, Dataset1.fastq for the example dataset.

Preview and Execution

Preview jobs with Snakemake and run with {n} cores.

#preview jobs
snakemake -np

#run
snakemake -j{n}

For more info on Snakemake, see https://snakemake.readthedocs.io/en/stable/

Conda setup

Some (without root access) may prefer to setup PorpidPostproc in a conda environment.

To accomplish this, first install anaconda locally. (the install script allows you to choose the location for anaconda, by default /home/user but choose something else if you want something accessable to a group of users)

curl –O https://repo.anaconda.com/archive/Anaconda3-2021.05-Linux-x86_64.sh > Anaconda3-2021.05-Linux-x86_64.sh
bash Anaconda3-2021.05-Linux-x86_64.sh

then log out and log in again and check that you are in the base environment.

conda is very slow, so we suggest installing mamba in the conda base environment:

conda install -n base -c conda-forge mamba

clone the PorpidPostproc repository

cd ~  # or some other directory used for your anaconda installation
git clone -b h705mod1 https://gitlab.com/hugh.murrell/porpidpostproc.git

and then all the PorpidPostproc dependencies including julia version 1.7.1 ( as listed in the PorpidPostproc conda environment spec in environment.yaml), can be installed in a conda environment via mamba using the commands:

conda config --add channels conda-forge
conda config --add channels bioconda
mamba env create --file environment.yaml

Note that if you did use some other directory than your home directory for installing the PorpidPostproc repository then you have to inform Julia where your packages are stored by placing the following command in your .bashrc file:

# set path to .julia files
export JULIA_DEPOT_PATH="/some/other/directory/.julia"

to complete the setup, activate the new PorpidPostproc conda environment,

conda activate PorpidPostproc

and continue with the julia package environment setup as outlined above in the quick start section.