Skip to content

StringRandomizer

afaji edited this page Mar 20, 2017 · 2 revisions

StringRandomizer

StringRandomizer randomly generates a string.

To begin, you have to include

#include "tcrand/string.hpp"

This will enable StringRandomizer and GrammarRandomizer class. Next, you can create your randomizer object as follow:

tcrand::StringRandomizer str_rand;

Setting Parameters

You may set some parameters for your StringRandomizer, by calling methods below:

  • length(N) - generated string's length will be exactly N
  • length(Nmin, Nmax) - generated string's length will be from Nmin to Nmax
  • charset(E) - E is a regex. Every characters in your string are going to match E.
  • first_charset(E) - E is a regex. The first character in your string is going to match E.
  • last_charset(E) - E is a regex. The last character in your string is going to match E.
  • palindrome() - generated string will be a palindrome

Once you're done configuring the randomizer, call method `next() to randomly generate a string.

Example

StringRandomizer str_rand;
str_rand.charset("[GTCA]").length(20).palindrome();
cout<< str_rand.next() <<endl;

The code above will generate a palindrome DNA string with a length of 20. The output will be (may vary):

AGGCATCCGTTGCCTACGGA

If you need more complex string generator that can generate a more structured string, see CfgStringRandomizer.

Clone this wiki locally