GJSrMap: The smallRNA mapping pipeline

Overview:

An open source and fully customized pipeline that:

• Maps all small non-coding RNAs to customized and comprehensive reference sequences
• Is modularized and iterative
• Run on an HPCC cluster (default) or on a computer/server
• Performs quality control on the data
• Provides a detailed summary of mapping:
  • FastQC plots for every iteration
  • MultiQC plots for every iteration
  • Summary plots and statistics of smallRNA distribution and abundance
• Provides raw and normalized (RPKM) counts
• Detailed logs of every iteration and steps

Description

1. gjsrmap: SmallRNA mapping and analysis pipeline schematic:

   

   • Pre-processing of the sequences:

     • This is the iteration 0 in the above schematic diagram
     • Preprocessing of the sequences to avoid multi mapping of the reads
     • Build custom reference sequence indexes
     • Removal of low quality reads
     • Removal of 3' adapter sequences and size reduction of the reads

   • Iterative mapping of processed and filtered reads:

     • Iteration 1: Map reads between 16 to 33 bp to custom reference sequences of mature microRNAs and piRNAs

     • Iteration 2: Map reads greater than 32 bp to custom reference sequences of other small non-coding RNAs. These are:

       | Other small non-coding RNAs | Description                                          |
       |-----------------------------|------------------------------------------------------|
       | rRNA                        | Ribosomal RNA                                        |
       | scRNA                       | Small cytoplasmic RNA                                |
       | snRNA                       | Small nuclear RNA                                    |
       | snoRNA                      | Small nucleolar RNA                                  |
       | premiRNA                    | microRNA precursors                                  |
       | osncRNA                     | Other small noncoding RNA                            |
       | - tRNA                      | - Transfer RNA                                       |
       | - Mt-tRNA                   | - Transfer RNA located   in the mitochondrial genome |
       | - misc_RNA                  | - Miscellaneous other RNA                            |
       
       

     • Iteration 3: Map the unmapped reads from iteration 1 and 2 to the species reference genome

   • Count the reads and distribute them to individual smallRNA classes

   • Generate QC, mapping and summary report

     

     • Sequence quality information
     • Bar plot of library sizes
     • Small non-coding RNA reads distrubution
     • Profile of expressed small non-coding RNAs (miRNAs in the above figure). Plots are also generated for other classes as well

Dependencies:

• bedtools
• bowtie
• bowtie2
• cutadapt
• fastqc
• matplotlib
• multiqc
• numpy
• samtools
• scipy

Usage:

• Run wrapper with following options:

SPC=${1}                                            # Species: hsa or mmu or some other species
IFD=${2}                                            # Input Fastq Dir: input/fastq/test
ORD=${3}                                            # Output Results Dir: output/test
BWD=${4}                                            # path/to/bowtie/indexes
QUE=${5:-"fat"}                                     # mpi, fat, mpi-short, fat-short, mpi-long, fat-long
SPK=${6:-""}                                        # exiseq_spikein_dna_unique.fa or spike_rna1_unique.fa
threePadapter=${7:-"TGGAATTCTCGGGTGCCAAGG"}         # trueseq adapter
JID=${8:-"$(echo $HOME)/gjsrmap"}                   # Job dir
NCL=${9:-"input/annotation/rna_classes"}            # ncrna folder containing ncrna class fasta

• Example command:
  bash 06_run_ncRNA_mapping_usage.sh <above mentioned arguments>