This repository contains code for pretraining METAGENE-1: Metagenomic Foundation Model.
METAGENE-1 is a 7-billion-parameter autoregressive transformer language model, which we refer to as a metagenomic foundation model, pretrained on a novel corpus of diverse metagenomic DNA and RNA reads sequenced from wastewater.
This repository contains code for pretraining METAGENE-1. It aims to provide a reference for future pretraining efforts. Note that the metagenomic pretraining dataset is not yet public (see data details below). However, this repository will be updated in the future as the metagenomic data is publically released.
Note
This repository is still being organized for release, but is provided as a helpful reference in the meantime.
train
: pretraining code for METAGENE-1.- Data
- Model
genomicsllama.yml
: pretrain configuration for genomics-llama.config
: model configuration for genomics_llama.
- Train
pretrain.py
: pretraining model, e.g., initialize weights, setup optimizers, setup dataloaders, setup fabric, run training.
To install dependencies, run:
cd train
pip install -e .
pip install -e '.[all]'
pip install -r minbpe/requirements.txt
Before running pretraining, you will need to update lines in train/litgpt/data/nao.py
to point to an s3 bucket containing tokenized metagenomic data files in MosaicML
streaming format.
And then run:
cd train
python litgpt/pretrain.py --config config_hub/pretrain/genomicsllama.yml
Or, as an example with more configurations shown:
cd train
python litgpt/pretrain.py --config config_hub/pretrain/genomicsllama.yml --fsdp_strategy
_HYBRID_SHARD_ZERO2 --model_name genomics-llama-7b --attention_impl fa --fake_data False
--train.log_stability_interval 25 --eval.interval 25 --train.save_interval 500
METAGENE-1 is trained on a newly collected metagenomic dataset comprising material from a very broad range (e.g., tens of thousands) of organisms, which was collected via metagenomic sequencing of human wastewater (i.e., municipal influent). This approach contrasts with prior genomic sequence models, which often focus on curated collections of specific species or genomic types.
In this implementation, data for pretraining is streamed from a given s3 bucket using MosaicML's streaming package. If you want to use this code as-is, you will need to specify an s3 bucket containing MosaicML streaming-compatible data here and here.
Note
The metagenomic pretraining dataset is not yet available for public release, but will be publicly available in the coming months. When it is available, we will update this section of the README with details.
We trained a BPE tokenizer on ~150M sequence reads (2B base pairs) sampled uniformly at random from our full set of data files. Some examples from our vocabulary are listed below.
A few short tokens:
· AA
· GG
· TAC
· AAAA
· ACCC
· ATCC
· TTCC
· AGCC
A few longer tokens:
· ATTTCACCGC
· TGCCTCCCGTAGG
· TCATTATGCAAAAGGC
· GTATTACCGCGGCTGCTGGC
· ACTACCAGGGTATCTAATCCTGTT
· ACCGTTGCCGGCGTACTCCCCAGGTGGATAGCTTAATGGTTTCCCTCAGGCACCC