add embl sarscov fasta

[famosab]

No description provided.

[vagkaratzas]

I don't think there is an EMBL fasta format. The EMBL format should be something like this:

ID   XYZ12345; SV 1; linear; genomic DNA; HUM; 2000 BP.
AC   XYZ12345;
DE   Homo sapiens genomic DNA, chromosome 1, sample gene.
XX
SQ   Sequence 2000 BP; 500 A; 300 C; 600 G; 600 T;
     ATGCGTACGTAGCTAGCTAGGCGATCGATCGTACGTACGATCGTAGCGATCGTACGATCGA
     TCGTAGCTAGCTAGCTAGCTAGCTAGCTGAGCGTAGCTAGCGTAGCTGAGCTAGCTAGCA
     TCGTAGCTAGCAGTAGCAGCGTACGTAGCTAGTGCATCGGAGCGTACGATCGTAGCTAGC
     AGCTGAGCTGAGCGTACGTCAGTCGATGAGCGTACAGCGTACGTGAGCGTAGCTAGTGA
     TAGTAGCGTACGAGCGTAGGCTAGCGTAGCTGAGC

https://indra.mullins.microbiol.washington.edu/sms2/embl_fasta.html

The provided .fasta is just a regular nucleotide sequence fasta file, with an ENA associated header.

[famosab]

Ah ok then the description is just wrong but the file that I submitted is the one I need haha. I can adjust that in the readme?

[vagkaratzas]

Ah ok then the description is just wrong but the file that I submitted is the one I need haha. I can adjust that in the readme?

If it's for a specific module that can't run with the existing fasta files then sure. Just rename to something like this:
'genome-ena.fasta': ENA associated fasta sequence

If it's pipeline specific, then just move it to the pipeline's test-datasets branch